View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2926_low_49 (Length: 293)
Name: NF2926_low_49
Description: NF2926
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2926_low_49 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 144; Significance: 9e-76; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 144; E-Value: 9e-76
Query Start/End: Original strand, 11 - 207
Target Start/End: Original strand, 33271964 - 33272161
Alignment:
| Q |
11 |
gatgaacaaaa-ttctaaaccaaatactatatgnnnnnnncttgctacatataagcatatccataacaacatatcaaatcatcgaagttttggctcttnn |
109 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
33271964 |
gatgaacaaaacttctaaaccaaatactatatgaaaaaaacttgctacatataagcatatccaaaacaacatatcaaatcatcgaagttttggctcttaa |
33272063 |
T |
|
| Q |
110 |
nnnnntcataaaagtttgaatcaagtagatgatagggagattaattgattgacgaactaatttcagatgttagttcgtgacaaaaatggaaaaatgga |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33272064 |
aaaaatcataaaagtttgaatcaagtagatgatagggagattaattgattgacgaactaatttcagatgttagttcgtgacaaaaatggaaaaatgga |
33272161 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 244 - 276
Target Start/End: Original strand, 33272149 - 33272181
Alignment:
| Q |
244 |
atggaaaaatggaacataagttatgtagatctt |
276 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| |
|
|
| T |
33272149 |
atggaaaaatggaacacaagttatgtagatctt |
33272181 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University