View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2926_low_50 (Length: 292)
Name: NF2926_low_50
Description: NF2926
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2926_low_50 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 154; Significance: 1e-81; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 154; E-Value: 1e-81
Query Start/End: Original strand, 27 - 188
Target Start/End: Original strand, 40837557 - 40837717
Alignment:
| Q |
27 |
aggtgaatagtggtttatgtcgatggtgcatatatttggattaaatgactctaagcaagggtgatcatggtgcacttttcccctcaagaaataaatttaa |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
40837557 |
aggtgaatagtggtttatgtcgatggtgcatatatttggattaaatgactctaagcaagggtgatcatggtgcacttt-cccctcaagaaataaatttaa |
40837655 |
T |
|
| Q |
127 |
tattgtatggactaataacccataattagatattaaactcacaataataaatactacacttt |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40837656 |
tattgtatggactaataacccataattagatattaaactcacaataataaatactacacttt |
40837717 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 175 - 282
Target Start/End: Original strand, 40837738 - 40837845
Alignment:
| Q |
175 |
aaatactacactttatcttgtcgtgcattatgtaaattaaaatctaattgtaattgtaaaaatttgagccgcaatagaatgaggacaaatttttcatctt |
274 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||| ||||||||||| |
|
|
| T |
40837738 |
aaatactacactttatcttgtcgtgcattatgtaaattaaaatctaattgtaattgtaaaaatttgagccgcaatagaacggggacaagtttttcatctt |
40837837 |
T |
|
| Q |
275 |
cgcctttg |
282 |
Q |
| |
|
|| ||||| |
|
|
| T |
40837838 |
cgtctttg |
40837845 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University