View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2926_low_61 (Length: 258)
Name: NF2926_low_61
Description: NF2926
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2926_low_61 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 20 - 246
Target Start/End: Complemental strand, 37735935 - 37735708
Alignment:
| Q |
20 |
ttggaaaataattactagttaaattttacgga-ttttgatcaaattttgtattatcaaatcctttttctttaaaaatcggaaggttagaaagatagcaat |
118 |
Q |
| |
|
|||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
37735935 |
ttggaaaagaattactagttaaattttacggacttttgatcaaattttgtattatcaaaccctttttctttaaaaatcggaaggttagaaagatagcagt |
37735836 |
T |
 |
| Q |
119 |
tatattactagttttttggttaaaaacaattgacacgaactccaaatgcactcaacttcaagcaattctaactaaatcgttatcatagttttcacattct |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||| |
|
|
| T |
37735835 |
tatattactagttttttggttaaaaacaattgacacgaactccaaatgcactcaacttcaagcaactctaactaaatcgttatcatagttttcacactct |
37735736 |
T |
 |
| Q |
219 |
agatcttagaccgatgtcttcatattca |
246 |
Q |
| |
|
| |||||||||||||||||||||||||| |
|
|
| T |
37735735 |
aaatcttagaccgatgtcttcatattca |
37735708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University