View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2926_low_66 (Length: 251)
Name: NF2926_low_66
Description: NF2926
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2926_low_66 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 20 - 242
Target Start/End: Complemental strand, 55718602 - 55718380
Alignment:
| Q |
20 |
gtggcgaaatctcatcgacagcaccgacttcatttttcttcatctaagcaaatctcgagattccgttatcattctccgtcaacactctcgtctctacgaa |
119 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55718602 |
gtggcgaaatctcatcgacagcactgacttcatttttcttcatctaagcaaatctcgagattccgttatcattctccgtcaacactctcgtctctacgaa |
55718503 |
T |
 |
| Q |
120 |
ttggatttgaactccatggatagagttaaagaactcgatcatcctttgatgtgttacagtaaccgcatcaaggtgttaggttcctgcaacggtcttctat |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55718502 |
ttggatttgaactccatggatagagttaaagaactcgatcatcctttgatgtgttacagtaaccgcatcaaggtgttaggttcctgcaacggtcttctat |
55718403 |
T |
 |
| Q |
220 |
gcatctgcaatattgctgatgat |
242 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
55718402 |
gcatctgcaatattgctgatgat |
55718380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University