View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2926_low_70 (Length: 248)

Name: NF2926_low_70
Description: NF2926
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2926_low_70
NF2926_low_70
[»] chr8 (1 HSPs)
chr8 (1-234)||(2104093-2104326)


Alignment Details
Target: chr8 (Bit Score: 226; Significance: 1e-125; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 226; E-Value: 1e-125
Query Start/End: Original strand, 1 - 234
Target Start/End: Original strand, 2104093 - 2104326
Alignment:
1 tctattatcgctttgttttaatgtgtctaaactagataatatagaggaagttagagattcacttatttgcatgccatgcgggtagtggtgtgcaggggca 100  Q
    ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2104093 tctattatcgctttgttttaatgtgtctaaacttgataatatagaggaagttagagattcacttatttgcatgccatgcgggtagtggtgtgcaggggca 2104192  T
101 atatagtattacttttagttcaaatgacgaaataaaggaaaatagttagtggtctatgattgaatcaattgagcttgcttgatttcattccatatttaaa 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||    
2104193 atatagtattacttttagttcaaatgacgaaataaaggaaaatagttggtggtctatgattgaatcaattgagcttgcttgatttcattccatatttaaa 2104292  T
201 ttataatcataattattcttttgcaggtactatt 234  Q
    ||||||||||||||||||||||||||||||||||    
2104293 ttataatcataattattcttttgcaggtactatt 2104326  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University