View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2926_low_71 (Length: 244)
Name: NF2926_low_71
Description: NF2926
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2926_low_71 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 5 - 244
Target Start/End: Original strand, 23217189 - 23217428
Alignment:
| Q |
5 |
cagaacaatagtgatttattaaaattcctatagtgctataaaactgctacatccactatttggcaacacggaaacaattaattaaaacaatttctctttg |
104 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||| |
|
|
| T |
23217189 |
cagaacaataatgatttattaaaattcctatagtgctataaaactgctacatccactatttggcaacacggaaacaattcattgaaacaatttctctttg |
23217288 |
T |
 |
| Q |
105 |
gatatgttgtatcgaaaatcggaacaaaaaatagttattttcagtgtcaatagtctactttaaacactacatgatacctggtgataatcacaggtgtgcc |
204 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23217289 |
gatatgttgtatcgaaaatcgaaacaaaaaatagttattttcagtgtcaatagtctactttaaacactacatgatacctggtgataatcacaggtgtgcc |
23217388 |
T |
 |
| Q |
205 |
tgaataagcagcacaaacagcagcattaaccttagcagtc |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23217389 |
tgaataagcagcacaaacagcagcattaaccttagcagtc |
23217428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University