View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2926_low_76 (Length: 242)
Name: NF2926_low_76
Description: NF2926
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2926_low_76 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 93; Significance: 2e-45; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 73 - 237
Target Start/End: Original strand, 43750281 - 43750444
Alignment:
| Q |
73 |
cttttgttgagctccactaactaaccacnnnnnnnnaagaagtcaaactaactactagctgttcaaatcttcttaaaaacggggttctaatcaaaaggaa |
172 |
Q |
| |
|
||||||||||||||||||| |||| ||| |||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
43750281 |
cttttgttgagctccactagctaatcacttttttttaagaagtcaaactaactattagctgttctaatcttcttaaaaacggggttctaatcaaaaggaa |
43750380 |
T |
 |
| Q |
173 |
taccaaatactnnnnnnnnncacatcacttatttaatgctaaatggatcttaagtatattcgtct |
237 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43750381 |
taccaaatact-aaaaaaaacacatcacttatttaatgctaaatggatcttaagtatattcgtct |
43750444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University