View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2926_low_89 (Length: 231)
Name: NF2926_low_89
Description: NF2926
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2926_low_89 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 5 - 231
Target Start/End: Original strand, 36779332 - 36779558
Alignment:
| Q |
5 |
aagatcaatgtactctgtccttttgttgctcccgaaaagcacggaagcgtcacccacaagcctgttcttggacaaggctaacctctcaagatttagttgg |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36779332 |
aagatcaatgtactctgtccttttgttgctcccgaaaagcacggaagcatcacccacaagcctgttcttggacaaggctaacctctcaagatttagttgg |
36779431 |
T |
|
| Q |
105 |
cccaatgaagctggaatgggtccagaaagcttgttctcgtgcaagaataaatgtttgaggttagtcagctgggaaagtgaactcggtattgagcccgtca |
204 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36779432 |
cccaatgaagctggaatgtgtccagaaagcttgttctcgtgcaagaataactgtttgaggttagtcagctgggaaagtgaactcggtattgagcccgtca |
36779531 |
T |
|
| Q |
205 |
gtttgttggaataaaggtcaaggagct |
231 |
Q |
| |
|
|||||||||| ||||||||||| |||| |
|
|
| T |
36779532 |
gtttgttggagtaaaggtcaagaagct |
36779558 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University