View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2926_low_93 (Length: 228)
Name: NF2926_low_93
Description: NF2926
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2926_low_93 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 17 - 212
Target Start/End: Complemental strand, 38013774 - 38013572
Alignment:
| Q |
17 |
agatagagttgaaaattaaccagctaatggaaattattgaaaccccagttagcgtaattgtccatggctgacacctaaaacaaa----------tacatc |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
38013774 |
agatagagttgaaaattaaccagctaatggaaattattgaaaccccagttagcgtaattgtccatggctgacacctaaaacaaaacatgacaaatacatc |
38013675 |
T |
 |
| Q |
107 |
aaatttagttctaaaaattgaagaaaatgattaaggaatgaagatgaaccataccaagatggtttggtgtcccaaacagattcgtattcgagggaaaggt |
206 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38013674 |
aaatttagttctaaaaattgaa---aatgattaagtaatgaagatgaaccataccaagatggtttggtgtcccaaacagattcgtattcgagggaaaggt |
38013578 |
T |
 |
| Q |
207 |
tgttga |
212 |
Q |
| |
|
|||||| |
|
|
| T |
38013577 |
tgttga |
38013572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University