View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2926_low_98 (Length: 218)
Name: NF2926_low_98
Description: NF2926
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2926_low_98 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 16 - 206
Target Start/End: Complemental strand, 33412695 - 33412494
Alignment:
| Q |
16 |
caacattgaggtatatacttttgattatttcctagcttaatta-----------cagacatttcagattgaaggcaatgtctgacacatgtcaatgttgg |
104 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
33412695 |
caacattgaggtatatacttttgattatttcctagcttaattaaccgtaacacacagacatttcagattgaaggcaatgtgtgacacatgtcaatgttgg |
33412596 |
T |
 |
| Q |
105 |
acacggacccgacaccgacacatgttactatattcaattaaaattatttatggtgtcgatatgttagtgtagtgtccgatgtttgtgttagtacttcatc |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
33412595 |
acacggacccgacaccgacacatgttactatattcaattaaaattatttatgctgtcgatatgttagtgtagtgtacaatgtttgtgttagtacttcatc |
33412496 |
T |
 |
| Q |
205 |
tc |
206 |
Q |
| |
|
|| |
|
|
| T |
33412495 |
tc |
33412494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University