View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2927_high_6 (Length: 258)
Name: NF2927_high_6
Description: NF2927
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2927_high_6 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 20 - 250
Target Start/End: Original strand, 39964060 - 39964289
Alignment:
| Q |
20 |
cctccgccatggttattaaaccctaactagtagatctttttctatggtttatgctttgttttctgtgtcactgcgttctcaatttcagaaagaaaataga |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39964060 |
cctccgccatggttattaaaccctaactagtagatctttttctatggtttatgctttgttttctgtgtcactgcgttctcaatttcagaaagaaaataga |
39964159 |
T |
 |
| Q |
120 |
aatggtgctatgaattcgatcgaacttgcttctaagtttcccgctcaaaacacagtcttccctgcaaatcttctgtgttactgttgggccgggtagtggc |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||| |
|
|
| T |
39964160 |
aatggtgctatgaattcgatcgaacttgcttctaagtttcccgctcaaaacacagtcttccctac-aatcttctgtgttactgttgggccgggtagtggc |
39964258 |
T |
 |
| Q |
220 |
tgcttattatgggcccgttttgtttcatatc |
250 |
Q |
| |
|
|||||||||||||||||| ||||||| |||| |
|
|
| T |
39964259 |
tgcttattatgggcccgtattgtttcgtatc |
39964289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University