View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2928_low_6 (Length: 251)
Name: NF2928_low_6
Description: NF2928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2928_low_6 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 14 - 251
Target Start/End: Complemental strand, 14363253 - 14363012
Alignment:
| Q |
14 |
agatgttttgtacttgggcaacgctggaaa--aatctcgcgaatgtatcacgagtgtgaaagtgttttgataacnnnnnnntaaaacaactcccacttac |
111 |
Q |
| |
|
|||||||||||||||||||||| || | | |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
14363253 |
agatgttttgtacttgggcaacactatacatcaatctcgcgaatgtatcacgagtgtgaaagtgttttgataacaaaaaaataaaacaactcccacttac |
14363154 |
T |
|
| Q |
112 |
ggtag--ggtggttaccgaaattaaatgatattgctgctagcttgtcgtgaattttcacgaattgttttttcgctatataaaacattagtctttgtactt |
209 |
Q |
| |
|
||||| || || ||||||||||||||||||||||| |||||||||||||||||| | | ||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
14363153 |
ggtagagggcggctaccgaaattaaatgatattgctactagcttgtcgtgaatttccgcaaattgttttttcgctatataaaacattagcctttgtactt |
14363054 |
T |
|
| Q |
210 |
tatggatgtcgttgtgtagtggttggagttcaaactccaaat |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
14363053 |
tatggatgtcgttgtgtagtggttggagttcaaattccaaat |
14363012 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University