View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2929_high_9 (Length: 242)
Name: NF2929_high_9
Description: NF2929
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2929_high_9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 143; Significance: 3e-75; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 74 - 220
Target Start/End: Complemental strand, 14995773 - 14995627
Alignment:
| Q |
74 |
ttgttttatgttattattaattataagacctacctgagccctttagtttcaatagatatcaaggtttctaacaaagtggtttatagtttaatcctagtaa |
173 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14995773 |
ttgttttatgttattattaattataagacctacctgagccctttagtttcaatagatatcaaggtttctaacaaagtggtttatagtttaatcctagtaa |
14995674 |
T |
 |
| Q |
174 |
atacagatcagttggtagctctatagacattggaatgcagggggcaa |
220 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
14995673 |
atacagatcagttggttgctctatagacattggaatgcagggggcaa |
14995627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 1 - 69
Target Start/End: Complemental strand, 14995882 - 14995814
Alignment:
| Q |
1 |
tatatttgtgaccggagggtgtagtttgttgctattttgccatgtgagttctataaattttggaactcc |
69 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14995882 |
tatatttgtgaccggagggtgtagtttgttgctattttgccatgtgagttctataaattttggaactcc |
14995814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University