View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2929_low_13 (Length: 241)
Name: NF2929_low_13
Description: NF2929
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2929_low_13 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 18 - 237
Target Start/End: Original strand, 39788678 - 39788914
Alignment:
| Q |
18 |
gtggaggaggatatgctcctcatgtaatggttggtcaaggactacttggcctcat----------------gttttatattatgtgacaaaaggtaatga |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
39788678 |
gtggaggaggatatgctcctcatgtaatggttggtgaaggactacttggcctcatgttttaattttatcatgttttatattatgtgacaaaaggtaatga |
39788777 |
T |
 |
| Q |
102 |
caatgatttttccaagtacttttcatttggaccgtcaactcttaaccaagcaaaacagctcacttagtatttgatg-ttttgctttaacaaattcagcca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
39788778 |
caatgatttttccaagtacttttcatttggaccgtcaactcttaaccaagcaaaacagctcacttagtatttgatgtttttgctttaacaaattcagcca |
39788877 |
T |
 |
| Q |
201 |
tacaaactcatccaaacaccttgtccaccactcaatt |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39788878 |
tacaaactcatccaaacaccttgtccaccactcaatt |
39788914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University