View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2929_low_14 (Length: 236)
Name: NF2929_low_14
Description: NF2929
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2929_low_14 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 218
Target Start/End: Complemental strand, 2194532 - 2194315
Alignment:
| Q |
1 |
ttcttgcatagttgttggcttttcttgaaagttgctatcgtttgttttgattggattgaaatgagtcattgtccttgtagagcttgtattttgtaaatag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||| |
|
|
| T |
2194532 |
ttcttgcatagttgttggcttttcttgaaagttgctatcgtttgttttgattggattgaaatgaatcattgtccttgtagaacttgtattttgtaaatag |
2194433 |
T |
 |
| Q |
101 |
caaaatatgtaataaagaatagtttaatatcaatctgtagtatatagccttttgtagaacttgatatttaaaatattatttggaggaattaatatcacat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||| |
|
|
| T |
2194432 |
caaaatatgtaataaagaatagtttaatatcaatttgtagtatatagccttttgtagaacttgatctttaaaatattatttggaggaattaatatctcat |
2194333 |
T |
 |
| Q |
201 |
cgtaatcatgtagatcta |
218 |
Q |
| |
|
||||||| |||||||||| |
|
|
| T |
2194332 |
cgtaatcgtgtagatcta |
2194315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University