View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2929_low_8 (Length: 255)
Name: NF2929_low_8
Description: NF2929
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2929_low_8 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 19 - 244
Target Start/End: Original strand, 31954114 - 31954339
Alignment:
| Q |
19 |
cttcattgctgcaatccctagctatgtgacccacctcaccgcacttatagcaagcgccgcctccaccacctccgctactaggagtagcgcaatctcttgc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31954114 |
cttcattgctgcaatccctagctatgtgacccacctcaccgcacttatagcaagcgccgcctccaccacctccgctactaggagtagcgcaatctcttgc |
31954213 |
T |
 |
| Q |
119 |
tatgtgaccaaccccaccacacctgtagcaagatgtgcttccaccaccatatccaccgccaccgttgttgttgttaccgcctccacgcatgcaatcccta |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31954214 |
tatgtgaccaaccccaccacacctgtagcaagatgtgcctccaccaccatatccaccgccaccgttgttgttgttaccgcctccacgcatgcaatcccta |
31954313 |
T |
 |
| Q |
219 |
gcaaaatgttcaaaagaaccacaggt |
244 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
31954314 |
gcaaaatgttcaaaagaaccacaggt |
31954339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University