View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2930_low_10 (Length: 392)
Name: NF2930_low_10
Description: NF2930
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2930_low_10 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 354; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 354; E-Value: 0
Query Start/End: Original strand, 19 - 392
Target Start/End: Original strand, 45746060 - 45746433
Alignment:
| Q |
19 |
tattagagccgatctctcaagctgaacatcactactacttcccattaatcccattggtgaactaataccaggcattgagcgaccatctccaagatcaagt |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45746060 |
tattagagccgatctctcaagctgaacatcactactacttcccatcaatcccattggtgaactaataccaggcattgagcgaccatctccaagatcaagt |
45746159 |
T |
 |
| Q |
119 |
cccattggcaaaggattgccgagggagcttgaaccaccaccaaaaccgttccttccaataccaagttccagaccagaatttgaggttggtagagccatgg |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45746160 |
cccattggcaaaggattgccgagggagcttgaaccaccaccaaaaccattccttccaataccaagttccagaccagaatttgaggttggtagagccatgg |
45746259 |
T |
 |
| Q |
219 |
gattagccaatgatgatattggtttgccaaggaacttgtttgttaaggcacatatacggttcaattcgtcctttagacgagcgttttcaattctaatctg |
318 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
45746260 |
gattagccaatgatgatattggtttgccaaggaacttgtttgttaaggcgcatatacggttcaattcatcctttagacgagcgttttcaattctaatctg |
45746359 |
T |
 |
| Q |
319 |
gtgctcctcaaacaatatttggccaggaattgctggtccaccacagttgttacatattggattcaccattgctt |
392 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45746360 |
gtgctcttcaaacaatatttggccaggaattgctggtccaccacagttgttacatattggattcaccattgctt |
45746433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University