View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2930_low_20 (Length: 335)
Name: NF2930_low_20
Description: NF2930
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2930_low_20 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 306; Significance: 1e-172; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 306; E-Value: 1e-172
Query Start/End: Original strand, 17 - 322
Target Start/End: Complemental strand, 42673611 - 42673306
Alignment:
| Q |
17 |
taaattgtttctccccttgagtcatatctggtcttaaggctttaactgcaacatcagtgttgtcaagtactcctttgaaaacaggtccatatccaccttc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42673611 |
taaattgtttctccccttgagtcatatctggtcttaaggctttaactgcaacatcagtgttgtcaagtactcctttgaaaacaggtccatatccaccttc |
42673512 |
T |
 |
| Q |
117 |
accaattttgccatccatatcaaagtaatttgttgcaacttcaatttcttcaatattgtatcttttaaatataaatttgttgcgttcaatttcatttgat |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42673511 |
accaattttgccatccatatcaaagtaatttgttgcaacttcaatttcttcaatattgtatcttttaaatataaatttgttgcgttcaatttcatttgat |
42673412 |
T |
 |
| Q |
217 |
gttgtcattctttcttcttcatcttcttcatgcacattaattaccttctgtttcgcgaaaccagcttctctaccaactgacgctgacctactcttctttt |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42673411 |
gttgtcattctttcttcttcatcttcttcatgcacattaattaccttctgtttcgcgaaaccagcttctctaccaactgacgctgacctactcttctttt |
42673312 |
T |
 |
| Q |
317 |
ttgttc |
322 |
Q |
| |
|
|||||| |
|
|
| T |
42673311 |
ttgttc |
42673306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 79 - 172
Target Start/End: Complemental strand, 6516163 - 6516070
Alignment:
| Q |
79 |
tcaagtactcctttgaaaacaggtccatatccaccttcaccaattttgccatccatatcaaagtaatttgttgcaacttcaatttcttcaatat |
172 |
Q |
| |
|
||||| || ||||| |||||||||||||| || ||||||||||||||| | | | |||||| ||| |||||||||| |||||||| ||||| |
|
|
| T |
6516163 |
tcaagcacacctttaaaaacaggtccataccccccttcaccaattttgagagcattgtcaaagccattagttgcaacttgaatttctttaatat |
6516070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University