View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2930_low_26 (Length: 282)
Name: NF2930_low_26
Description: NF2930
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2930_low_26 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 18 - 268
Target Start/End: Original strand, 25615377 - 25615627
Alignment:
| Q |
18 |
tgaaatttttgttctcaatgtattacataaattctttctatgttcgatgtccttgaatttgtaattttgtttggcattcctttatttattttaggttgct |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25615377 |
tgaaatttttgttctcaatgtattacataaattctttctatgttcgatgtccttgaatttgtaattttgtttggcattcctttatttattttaggttgct |
25615476 |
T |
 |
| Q |
118 |
tcagatgttacagaactcttggaaaatcatacataaaatggatgttgggaacaatttaattccaacggaagcttcaatttttgtttagaggctacctcca |
217 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25615477 |
ccagatgttaaagaactcttggaaaatcatacataaaatggatgttgggaacaatttaattccaacggaagcttcaatttttgtttagaggctacctcca |
25615576 |
T |
 |
| Q |
218 |
aaacacgatcccaactaaagataatttgatatgaagaagcatcatcaatac |
268 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
25615577 |
aaacacgatcccaactaaggataatttgatatgaagaagcatcatcaatac |
25615627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University