View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2930_low_27 (Length: 279)
Name: NF2930_low_27
Description: NF2930
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2930_low_27 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 111; Significance: 4e-56; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 1 - 111
Target Start/End: Original strand, 28142138 - 28142248
Alignment:
| Q |
1 |
atggcgcaacacagtctttgtttcttctctcactgaaagaagcgcttcttcattgactcacaacctctcattcatgacttgcaaaccagaaacaacactt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28142138 |
atggcgcaacacagtctttgtttcttctctcactgaaagaagcgcttcttcattgactcacaacctctcattcatgacttgcaaaccagaaacaacactt |
28142237 |
T |
 |
| Q |
101 |
tattcctattc |
111 |
Q |
| |
|
||||||||||| |
|
|
| T |
28142238 |
tattcctattc |
28142248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 195 - 261
Target Start/End: Original strand, 28142338 - 28142404
Alignment:
| Q |
195 |
gtcctttgcatttcagaagtttccgcaaatgtcccgccgggttaattatctgctttacgagaattcc |
261 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28142338 |
gtcctttgcatttcagaagtttccgcaaatgtcccgccgggttaattatctgctttacgagaattcc |
28142404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University