View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2930_low_28 (Length: 260)
Name: NF2930_low_28
Description: NF2930
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2930_low_28 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 211; Significance: 1e-116; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 244
Target Start/End: Complemental strand, 49764562 - 49764319
Alignment:
| Q |
1 |
cctccatgctcctcccaacttcttgtacttgaaccgagtacaatagctctaaccctagtagcagtgtgcttttcgagagtcagagtagtaggtagtgaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49764562 |
cctccatgctcctcccaacttcttgtacttgaaccgagtacaatagctctaaccctagtagcagtgtgcttttcgagagtcagagtagtaggtagtgaat |
49764463 |
T |
|
| Q |
101 |
ataggtcatctcctctttgggagcgtaggtttggtatttatnnnnnnnttaccctagaggaaagcggaactgctccagttcacgtcttcccacgacgacc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||| |||||||||||||||||||||| |
|
|
| T |
49764462 |
ataggtcatctcctctttgggagcgtaggtttggtatttatgggggggttaccctagaggaaagcggaactactccaattcacgtcttcccacgacgacc |
49764363 |
T |
|
| Q |
201 |
ctttcttctcgccctctccccctaactataggcacattgtgcat |
244 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
49764362 |
ctttcttctcgccctctccccctgactataggcacattgtgcat |
49764319 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 23 - 109
Target Start/End: Complemental strand, 21272568 - 21272482
Alignment:
| Q |
23 |
ttgtacttgaaccgagtacaatagctctaaccctagtagcagtgtgcttttcgagagtcagagtagtaggtagtgaatataggtcat |
109 |
Q |
| |
|
||||| ||||| |||||||||||||||||||||| || || ||||||||| |||||||||||| ||||| ||||||||||||||| |
|
|
| T |
21272568 |
ttgtatttgaattgagtacaatagctctaaccctattaacaatgtgctttttcagagtcagagtaataggttgtgaatataggtcat |
21272482 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 33; Significance: 0.000000001; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 24 - 108
Target Start/End: Original strand, 10325329 - 10325413
Alignment:
| Q |
24 |
tgtacttgaaccgagtacaatagctctaaccctagtagcagtgtgcttttcgagagtcagagtagtaggtagtgaatataggtca |
108 |
Q |
| |
|
||||||||||| |||| ||||||||||||||| || |||||||||| ||||||||||| |||||||||||| ||||||| |
|
|
| T |
10325329 |
tgtacttgaacgaagtataatagctctaaccctgactgcggtgtgctttttcagagtcagagtgataggtagtgaatttaggtca |
10325413 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 38 - 85
Target Start/End: Complemental strand, 1622554 - 1622507
Alignment:
| Q |
38 |
gtacaatagctctaaccctagtagcagtgtgcttttcgagagtcagag |
85 |
Q |
| |
|
||||||||| || |||||||| ||||||||||||||| |||||||||| |
|
|
| T |
1622554 |
gtacaatagttccaaccctagcagcagtgtgcttttctagagtcagag |
1622507 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University