View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2930_low_37 (Length: 240)
Name: NF2930_low_37
Description: NF2930
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2930_low_37 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 111; Significance: 4e-56; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 83 - 224
Target Start/End: Original strand, 7583957 - 7584103
Alignment:
| Q |
83 |
taaaaatatattggtttactataacatttaaattttcaaaacaaagtagagaatagagat-----aacttttaacaaccactaggagttgttgtgtcatg |
177 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
7583957 |
taaaaacatattggtttactataacatttaaattttcaaaacaaagtagagaatagagataagataacttttaacaaccactaggagttgttgtgtcatg |
7584056 |
T |
 |
| Q |
178 |
aggggaccccaggatgatcacgaaaatttaagacataaggtatatag |
224 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||| ||||||| |
|
|
| T |
7584057 |
aggggacccagggatgatcacgaaaatttaagacataagttatatag |
7584103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 83 - 175
Target Start/End: Complemental strand, 7097218 - 7097131
Alignment:
| Q |
83 |
taaaaatatattggtttactataacatttaaattttcaaaacaaagtagagaatagagataacttttaacaaccactaggagttgttgtgtca |
175 |
Q |
| |
|
||||||| ||||| |||| || |||| ||||||||||||||||||||||| |||| ||||| |||||||||||||||||||| |||| |
|
|
| T |
7097218 |
taaaaatttattgatttagtagaacaacaaaattttcaaaacaaagtagaga-----gatagcttttcacaaccactaggagttgttgggtca |
7097131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University