View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2930_low_38 (Length: 237)

Name: NF2930_low_38
Description: NF2930
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2930_low_38
NF2930_low_38
[»] chr2 (1 HSPs)
chr2 (1-222)||(945719-945940)


Alignment Details
Target: chr2 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 945940 - 945719
Alignment:
1 actaaatcccaatccttgtggcaatagagtagggtgcaatgtattaaccatgtagagcaagacaacttgatcactatggtgagcgatggcagtatcgaaa 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
945940 actaaatcccaatccttgtggcaatagagtagggtgcaatgtattaaccatgtagagcaagacaacttgatcactatggtgagcgatggcagtatcgaaa 945841  T
101 tggcatactggtgggggaatggatcatttgtggacaagtacaccaatttctcatttattttgtatcttatacttatatggatatggattgcatcaaaatt 200  Q
    |||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
945840 tggcatactggtgggggaattggtcatttgtggacaagtacaccaatttctcatttattttgtatcttatacttatatggatatggattgcatcaaaatt 945741  T
201 tctctcaatcatctttggaatt 222  Q
    |||||||||||||||| |||||    
945740 tctctcaatcatcttttgaatt 945719  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University