View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2931-Insertion-14 (Length: 126)
Name: NF2931-Insertion-14
Description: NF2931
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2931-Insertion-14 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 97; Significance: 4e-48; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 97; E-Value: 4e-48
Query Start/End: Original strand, 7 - 107
Target Start/End: Original strand, 41875033 - 41875133
Alignment:
| Q |
7 |
agacataccgattagttcgaagtcgctcgtattcttgatcatagatcagaaagacaaagtacaattcacttttggtgcttcccattaggaatgaatcttt |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
41875033 |
agacataccgattagttcgaagtcgctcgtattcttgatcatagatcagaaagacaaagtacaattcacttttggtgcttcccattaagaatgaatcttt |
41875132 |
T |
 |
| Q |
107 |
c |
107 |
Q |
| |
|
| |
|
|
| T |
41875133 |
c |
41875133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University