View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2931R-Insertion-13 (Length: 86)
Name: NF2931R-Insertion-13
Description: NF2931R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2931R-Insertion-13 |
 | |
|
| [»] chr7 (2 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 70; Significance: 3e-32; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 70; E-Value: 3e-32
Query Start/End: Original strand, 9 - 86
Target Start/End: Original strand, 24391295 - 24391372
Alignment:
| Q |
9 |
atacacacaattgttgccccctagagattcccatgaagtgttgttgaatgagccaaccatttgtgtgctcatggattg |
86 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
24391295 |
atacacacaattgttgccccctagagattcccgtgaagtgttgttgaatgagtcaaccatttgtgtgctcatggattg |
24391372 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 35; E-Value: 0.00000000003
Query Start/End: Original strand, 8 - 86
Target Start/End: Original strand, 24385081 - 24385159
Alignment:
| Q |
8 |
aatacacacaattgttgccccctagagattcccatgaagtgttgttgaatgagccaaccatttgtgtgctcatggattg |
86 |
Q |
| |
|
||||||||||||||||||||||| || ||| ||||||||||||||||||| ||| |||||||||| |||||||| |
|
|
| T |
24385081 |
aatacacacaattgttgccccctcaaggttctgatgaagtgttgttgaatgaaacaagtctttgtgtgcttatggattg |
24385159 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University