View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2931R-Insertion-14 (Length: 70)
Name: NF2931R-Insertion-14
Description: NF2931R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2931R-Insertion-14 |
 | |
|
| [»] scaffold0267 (1 HSPs) |
| |
|
| [»] chr3 (2 HSPs) |
| |
|
Alignment Details
Target: scaffold0267 (Bit Score: 58; Significance: 4e-25; HSPs: 1)
Name: scaffold0267
Description:
Target: scaffold0267; HSP #1
Raw Score: 58; E-Value: 4e-25
Query Start/End: Original strand, 9 - 70
Target Start/End: Complemental strand, 5458 - 5397
Alignment:
| Q |
9 |
tataacactacgtactgccgtggcttccttcttttttattttagagtatctatcactttgct |
70 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
5458 |
tataacactacgtactgccgtggcttccttcttttttattttagggtatctatcactttgct |
5397 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 54; Significance: 9e-23; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 54; E-Value: 9e-23
Query Start/End: Original strand, 9 - 70
Target Start/End: Complemental strand, 3791961 - 3791901
Alignment:
| Q |
9 |
tataacactacgtactgccgtggcttccttcttttttattttagagtatctatcactttgct |
70 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
3791961 |
tataacactacgtactgccgtggcttccttct-ttttattttagagtatctatcactttgct |
3791901 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 54; E-Value: 9e-23
Query Start/End: Original strand, 9 - 70
Target Start/End: Complemental strand, 3829765 - 3829705
Alignment:
| Q |
9 |
tataacactacgtactgccgtggcttccttcttttttattttagagtatctatcactttgct |
70 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
3829765 |
tataacactacgtactgccgtggcttccttct-ttttattttagagtatctatcactttgct |
3829705 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University