View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2931_high_16 (Length: 224)
Name: NF2931_high_16
Description: NF2931
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2931_high_16 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 36 - 207
Target Start/End: Complemental strand, 53060390 - 53060219
Alignment:
| Q |
36 |
cgctaagtttcactattctgtccaaaattatgcaatgcagacacgacgtcaccagatacttgaccacttgtaagaggatagaaacccagagaaaaatatt |
135 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
53060390 |
cgctaagtttcactattctgtccaaaattatacaatgcagacacgacgtcaccagatacttgaccacttataagaggatagaaacccagagaaaaatatc |
53060291 |
T |
|
| Q |
136 |
tcaaaattgcgtcgaacagataattgacaacctacatgtgctaaaaatgtgggggtgttttgaccctataaa |
207 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
53060290 |
tcaaaattgcgtcgaacagatacttgacaacctacatgtgctaaaaaagtgggggcgttttgaccctataaa |
53060219 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University