View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2931_high_16 (Length: 224)

Name: NF2931_high_16
Description: NF2931
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2931_high_16
NF2931_high_16
[»] chr4 (1 HSPs)
chr4 (36-207)||(53060219-53060390)


Alignment Details
Target: chr4 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 36 - 207
Target Start/End: Complemental strand, 53060390 - 53060219
Alignment:
36 cgctaagtttcactattctgtccaaaattatgcaatgcagacacgacgtcaccagatacttgaccacttgtaagaggatagaaacccagagaaaaatatt 135  Q
    ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||     
53060390 cgctaagtttcactattctgtccaaaattatacaatgcagacacgacgtcaccagatacttgaccacttataagaggatagaaacccagagaaaaatatc 53060291  T
136 tcaaaattgcgtcgaacagataattgacaacctacatgtgctaaaaatgtgggggtgttttgaccctataaa 207  Q
    |||||||||||||||||||||| |||||||||||||||||||||||| ||||||| ||||||||||||||||    
53060290 tcaaaattgcgtcgaacagatacttgacaacctacatgtgctaaaaaagtgggggcgttttgaccctataaa 53060219  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University