View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2931_high_6 (Length: 368)
Name: NF2931_high_6
Description: NF2931
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2931_high_6 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 261; Significance: 1e-145; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 18 - 354
Target Start/End: Original strand, 38726980 - 38727295
Alignment:
| Q |
18 |
gatacagcttatattgcaccgtcccatatctaggctaatactgaagttattgctggagagggcttgattgtaacagctggggctatagattgccatgtgc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38726980 |
gatacagcttatattgcaccgtcccatatctaggctaatactgaagttattgctggagagggcttgattgtaacagctggggctatagattgccatgtgc |
38727079 |
T |
 |
| Q |
118 |
attttatatgccctcaattagtatatgaagccgtatcaagtggtgagtttcacaaagtttctgttgaaagggcttacttacatgagtattttaaatattt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38727080 |
attttatatgccctcaattagtatatgaagccgtatcaagtggtgagtttcacaaagtttctgttgaaagggcttacttacatgagtattttaaatattt |
38727179 |
T |
 |
| Q |
218 |
aatgcatgctctagtgtgctggaatcatgactgatagtaaattaaaatattcagttgtttgactttgagattattttggctgtgcgatacaatatctata |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
38727180 |
aatgcatgctctagtgtgctggaatcatgactgatagtaaattaaaat---------------------attattttggctgtgcaatacaatatctata |
38727258 |
T |
 |
| Q |
318 |
tgtactgtaggctcgcttagtggatttcatctagtcc |
354 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
38727259 |
tgtactgtaggctcgcttagtggattttatctagtcc |
38727295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University