View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2931_low_10 (Length: 298)
Name: NF2931_low_10
Description: NF2931
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2931_low_10 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 257; Significance: 1e-143; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 16 - 292
Target Start/End: Original strand, 11696690 - 11696966
Alignment:
| Q |
16 |
tcatttagggtctcctgatcttggaaagtgtatacacgggatcttgttgaggaacattagtgaactcaatgttgttgtgaagacttcgttaattgatatg |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11696690 |
tcatttagggtctcctgatcttggaaagtgtatacacgggatcttgttgaggaacattagtgaactcaatgttgttgtgaagacttcgttaattgatatg |
11696789 |
T |
 |
| Q |
116 |
tatgtcaagtgtggatgtcttgagaaaggtttacgcgtattcgagaatatgtcggagaagaatagattttcttacactgtaatgatatctggtcttgcga |
215 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||| | |||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
11696790 |
tatgtcaagagtggatgtcttgagaaaggtttacgcgtattcaaaaatatgtcggagaagaatagatattcttacactgtaatgatatctggtcttgcga |
11696889 |
T |
 |
| Q |
216 |
ttcatggacgtggtaaggaagctcttaaagttttctcagaaatgattgaagaaggtttggcaccagatgatgatgtc |
292 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
11696890 |
ttcatggacgtggtaaggaagctcttaaagttttctcagaaatgattgaagaaggtttggcaccagatgatgttgtc |
11696966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University