View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2931_low_15 (Length: 240)
Name: NF2931_low_15
Description: NF2931
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2931_low_15 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 121; Significance: 4e-62; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 12 - 164
Target Start/End: Complemental strand, 31771238 - 31771085
Alignment:
| Q |
12 |
atgaagcggcagagtgtgaaacgggcgaaaatattgaaaccgagagttggatacgggtc-acgggtttacaatcttgggcctnnnnnnngcccatgtata |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||| |
|
|
| T |
31771238 |
atgaagcggcagagtgtgaaacgggcgaaaatattgaaaccgagagttggatacgggtccacgggtttacaatcttgggcctaaaaaaagcccatgtata |
31771139 |
T |
|
| Q |
111 |
tactcttactctttgagagttgctcttctcctatctagaattactcattcctct |
164 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31771138 |
tgctcttactctttgagagttgctcttctcctatctagaattactcattcctct |
31771085 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 12709 times since January 2019
Visitors: 1126