View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2931_low_18 (Length: 234)
Name: NF2931_low_18
Description: NF2931
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2931_low_18 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 20 - 216
Target Start/End: Original strand, 40871423 - 40871619
Alignment:
| Q |
20 |
gaacggatgatggtgttgcagtgaaatgcgtcggggtggtggagatggtcgaagaagagagcggagcgtggggtggtgcgtggatgagaggagagnnnnn |
119 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
40871423 |
gaacggatgatggtgttgcagagaaatgcgtcggggtggtggagatggtcgaagaagagagcggagcttggggtggtgcgtggatgagaggagagttttt |
40871522 |
T |
|
| Q |
120 |
nnatggcggtggtggagagaagaggatgttgaatgagattattgatgatgagttgggtgtgaatttgtttgaagtgttggattccggtggttgattc |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||| |
|
|
| T |
40871523 |
ttatggcggtggtggagagaagaggatgttgaatgagattattgatgatgagttgggtgtgaatttggttgaagtgttgggttccggtggttgattc |
40871619 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University