View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2931_low_19 (Length: 233)
Name: NF2931_low_19
Description: NF2931
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2931_low_19 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 135; Significance: 2e-70; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 18 - 214
Target Start/End: Complemental strand, 5059311 - 5059114
Alignment:
| Q |
18 |
aagtatacttcatatttctccaaaagccttaagtattgttatcaatcta--gatatacannnnnnnngacagtatatagatacattgttagtgtcagggt |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
5059311 |
aagtatacttcatatttctccaaaagccttaagtattgttatcaatctatagatatacattttttttgacagtatatagatacattgttagtgtcagggt |
5059212 |
T |
 |
| Q |
116 |
atagtgtcatattagaatatcttgctttattagacatattatgaagnnnnnnnncttgtcacaaaaatttcctttcttcttgtattgatttgaatatct |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5059211 |
atagtgtcatattagaatatcttgctttattagacatattatgaag-aaaaaaacttgtcacaaaaatttcctttcttcttgtattgatttgaatatct |
5059114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 173 - 214
Target Start/End: Complemental strand, 5198442 - 5198401
Alignment:
| Q |
173 |
gtcacaaaaatttcctttcttcttgtattgatttgaatatct |
214 |
Q |
| |
|
||||||||| ||||||||||||||||||||| |||||||||| |
|
|
| T |
5198442 |
gtcacaaaagtttcctttcttcttgtattgacttgaatatct |
5198401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University