View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2931_low_6 (Length: 395)
Name: NF2931_low_6
Description: NF2931
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2931_low_6 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 174; Significance: 2e-93; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 174; E-Value: 2e-93
Query Start/End: Original strand, 44 - 276
Target Start/End: Complemental strand, 7456018 - 7455787
Alignment:
| Q |
44 |
cttggtgtcccttctgtaaaaaatgtggaggggcaacatcttttaccactaaaatattgtctgaaatctcaaaaatatttagaagactgtttaattttnn |
143 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
7456018 |
cttggtgtcccttctgtaaaaaatgtggaggggtaacatcttttaccactaaaatattgtctgaaatctcaaaaatatttagaagactgttta-tttttt |
7455920 |
T |
 |
| Q |
144 |
nnnnnnntgacagatgttaatcgttagttattagattaatatttcaccttttttcatgtttgaaatgagagaaagcaatacaaataatatgaaactgata |
243 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| | |||||||||||||||||| |
|
|
| T |
7455919 |
ttaaaaatgaccgatgttaatcgttagttattagattaatatttcaccctttttcatgtttgaaatgagagaaagcaatgctaataatatgaaactgata |
7455820 |
T |
 |
| Q |
244 |
tatattagcaaaaatggatatgtgcagaaagaa |
276 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |
|
|
| T |
7455819 |
tatattagcaaaaatggctatgtgcagaaagaa |
7455787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University