View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2931_low_9 (Length: 301)
Name: NF2931_low_9
Description: NF2931
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2931_low_9 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 3 - 284
Target Start/End: Original strand, 20473748 - 20474030
Alignment:
| Q |
3 |
cgcaatggtaaagttgttgtcactaaactaaaagctcacaagttcaagtcctagttcaacgggatccaacatcaattgatgcgtgagaacgactgataat |
102 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||| || |||||||||||||||||||||||| ||||||||| |||||||| ||||||||||||||| || |
|
|
| T |
20473748 |
cgcaatagtaaagttgttgtcactaaactaaaaggtcgcaagttcaagtcctagttcaacggcatccaacataaattgatgagtgagaacgactgatgat |
20473847 |
T |
|
| Q |
103 |
tgattcagtgagttcaacgatgggtgagttctgacggtgcaggttgaaaaagagagacgagggtggtggttggcgaggttgacagttgtgggttgaaaat |
202 |
Q |
| |
|
|||||||||| |||||||| || |||||||||||||||||| |||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20473848 |
tgattcagtgcgttcaacggtgtgtgagttctgacggtgcaagttgaataagagagacgacggtggtggttggcgaggttgacagttgtgggttgaaaat |
20473947 |
T |
|
| Q |
203 |
ggagagagaattgaacgagtgggtttagag-cagaagagtgagtgaaagtggacggtggtgggttagagaagcggcgatgggt |
284 |
Q |
| |
|
||||| |||||||| ||||||||| ||| ||||||||||||| |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
20473948 |
ggagaaagaattgactgagtgggttacgagacagaagagtgagttaaagaggacggtggtgggttagagaagcggcgatgggt |
20474030 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University