View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2932_high_31 (Length: 297)
Name: NF2932_high_31
Description: NF2932
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2932_high_31 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 20 - 286
Target Start/End: Complemental strand, 9446847 - 9446582
Alignment:
| Q |
20 |
taaggtaatttcattatactttttgtgtgtgatccagagtttattgatatcaacgatatcttttttattgaattttagtttgccatattgtgaatgtaac |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9446847 |
taaggtaatttcattatactttttgtgtgtgatccagagtttat-gatatcaacgatatcttttttattgaattttagtttgccatattgtgaatgtaac |
9446749 |
T |
 |
| Q |
120 |
ttgtgtgaaagctgagaaaattcaaccaaaacttggatatgattttgatgtaagnnnnnnnntttataaaaatgattcattctctatttggattatcttt |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9446748 |
ttgtgtgaaagctgagaaaattcaaccaaaacttggatatgattttgatgtaagaaaaaaaaattataaaaatgattcattctctatttggattatcttt |
9446649 |
T |
 |
| Q |
220 |
tataacaggactcttggacataagagtatccacatacttcctcattcaacatgttttttcccttcat |
286 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9446648 |
tataacaggactcttggacataagagtatgcacatacttcctcattcaacatgttttttcccttcat |
9446582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University