View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2932_high_49 (Length: 246)
Name: NF2932_high_49
Description: NF2932
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2932_high_49 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 1 - 229
Target Start/End: Complemental strand, 43539147 - 43538919
Alignment:
| Q |
1 |
tgattgttatgctctttccatcctcaactatttccacaatttctgttgacaataattgtacagagtaaggaacaaatttaccgttttcttcgctaccggt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43539147 |
tgattgttatgctctttccatcctcaactatttccacaatttctgttgacaataattgtacagagtaaggaacaaatttaccgttttcttcgctaccggt |
43539048 |
T |
 |
| Q |
101 |
gtccggtactatttcattaactctgtttttgttactactcaaatttttgagatctccaaatgtttcagaaatttctggagttagtatttcttggaagcta |
200 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43539047 |
gtccggtactatttcatgaactctgtttttgttactactcaaatttttgagatctccaaatgtttcagaaatttctggagttagtatttcttggaagcta |
43538948 |
T |
 |
| Q |
201 |
taagttccatttgtggcatatgttttatg |
229 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
43538947 |
taagttccatttgtggcatatgttttatg |
43538919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University