View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2932_high_55 (Length: 239)
Name: NF2932_high_55
Description: NF2932
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2932_high_55 |
 | |
|
| [»] scaffold0085 (1 HSPs) |
| |
|
| [»] scaffold0314 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold0085 (Bit Score: 103; Significance: 2e-51; HSPs: 1)
Name: scaffold0085
Description:
Target: scaffold0085; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 128 - 239
Target Start/End: Complemental strand, 53056 - 52943
Alignment:
| Q |
128 |
gcctccaatcaggctttccagtttcttaatgcagtagagaattttcaacaatagttaattgagtataagttgcaaagattgtgctgagcataagcat--c |
225 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
53056 |
gcctccaatcaggctttccagtttcttaatgcagtagagaattttcaacaatagttaattgagtataagttgcaaagattgtgctgagcataagcatacc |
52957 |
T |
|
| Q |
226 |
aagttgaaaatttt |
239 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
52956 |
aagttgaaaatttt |
52943 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0314 (Bit Score: 46; Significance: 2e-17; HSPs: 2)
Name: scaffold0314
Description:
Target: scaffold0314; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 19 - 64
Target Start/End: Original strand, 20253 - 20298
Alignment:
| Q |
19 |
agattccctatgtatgaactttgatgggattgtgccagtaaagttg |
64 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20253 |
agattccctatgtatgaactttgatgggattgtgccagtaaagttg |
20298 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0314; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 99 - 132
Target Start/End: Original strand, 20306 - 20339
Alignment:
| Q |
99 |
agttgaatatgctgtcggcctgtcacgatgcctc |
132 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| |
|
|
| T |
20306 |
agttgaatatgctgtcagcctgtcacgatgcctc |
20339 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University