View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2932_high_57 (Length: 237)

Name: NF2932_high_57
Description: NF2932
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2932_high_57
NF2932_high_57
[»] chr5 (2 HSPs)
chr5 (20-96)||(12445172-12445248)
chr5 (161-221)||(12445313-12445373)
[»] chr2 (1 HSPs)
chr2 (172-211)||(17466218-17466257)


Alignment Details
Target: chr5 (Bit Score: 73; Significance: 2e-33; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 20 - 96
Target Start/End: Original strand, 12445172 - 12445248
Alignment:
20 agttttcatattagctattatagtatgtacaatttgtgattactctccctttttaacttacctttttaaattatatg 96  Q
    |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
12445172 agttttcatattagctattataatatgtacaatttgtgattactctccctttttaacttacctttttaaattatatg 12445248  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 161 - 221
Target Start/End: Original strand, 12445313 - 12445373
Alignment:
161 ttcaggtattgaagtgatcattttctatttttactttaatccatgtgacacaacatatacc 221  Q
    ||||||||| ||||||||||||||||| |||||||||| ||||||||||||||||||||||    
12445313 ttcaggtatcgaagtgatcattttctacttttactttagtccatgtgacacaacatatacc 12445373  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 172 - 211
Target Start/End: Complemental strand, 17466257 - 17466218
Alignment:
172 aagtgatcattttctatttttactttaatccatgtgacac 211  Q
    |||||||||||||||| |||||||||||||||||||||||    
17466257 aagtgatcattttctacttttactttaatccatgtgacac 17466218  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University