View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2932_high_58 (Length: 237)
Name: NF2932_high_58
Description: NF2932
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2932_high_58 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 10 - 237
Target Start/End: Complemental strand, 47954669 - 47954443
Alignment:
| Q |
10 |
catcatcatattattattattagctggaagtagaggtagaagaaaagagaagagaagataacctctttgtatcgcatcatattattaatattatta---t |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| | |
|
|
| T |
47954669 |
catcatcatattattattattagctggaagtagaggtagaagaaaagagaagagaagataacctctttgtatcgcatcatattattattattattattat |
47954570 |
T |
 |
| Q |
107 |
tatgtcttgtttgctttgccttgcttgtttagtagtactcactcactcactgtctgtctgctatgatctgtctatctccacggctgttgagttgagttga |
206 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47954569 |
tatgtcttgtttgctttgccttgcttgcttagtagt----actcactcactgtctgtctgctatgatctgtctatctccacggctgttgagttgagttga |
47954474 |
T |
 |
| Q |
207 |
gttgtacactgccaaagcaaccacttttatt |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
47954473 |
gttgtacactgccaaagcaaccacttttatt |
47954443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University