View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2932_high_59 (Length: 235)

Name: NF2932_high_59
Description: NF2932
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2932_high_59
NF2932_high_59
[»] chr3 (1 HSPs)
chr3 (10-216)||(3934654-3934858)


Alignment Details
Target: chr3 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 10 - 216
Target Start/End: Original strand, 3934654 - 3934858
Alignment:
10 aggagcagagatggacttgtatcaccacggtggggatgggggatggagacgcacgccagcagggggcatgttgtaggagtagatgcaaatggtaaactaa 109  Q
    |||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3934654 aggatcagagatggacttgtatcaccaaggtggggatgggggatggagacgcacgccagcagggggcatgttgtaggagtagatgcaaatggtaaactaa 3934753  T
110 gaataagatttcgatggagggaagggaggagaccttggataggagaccctgctgatattgctcttgatgagaactga-ataaaactttataggaacatgg 208  Q
    ||||||||||||||||||||||||   ||||||||||||||||||||||||||||||||||||||||||||||||||  ||||||||| |||||||||||    
3934754 gaataagatttcgatggagggaag---ggagaccttggataggagaccctgctgatattgctcttgatgagaactgatgtaaaactttttaggaacatgg 3934850  T
209 aagcttgt 216  Q
    ||||||||    
3934851 aagcttgt 3934858  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University