View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2932_low_49 (Length: 250)
Name: NF2932_low_49
Description: NF2932
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2932_low_49 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 206; Significance: 1e-113; HSPs: 4)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 20 - 245
Target Start/End: Original strand, 11156857 - 11157082
Alignment:
| Q |
20 |
ccctcttctattcacttgttccccttcacttctacaaaatggttcatttgcagttgaaatttttcaaacccatgtttgtcaacttaaccaatctccatgg |
119 |
Q |
| |
|
||||||||||||||||||||| ||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11156857 |
ccctcttctattcacttgttcaccttcacttttacaaaatggttcatttccagttgaaatttttcaaacccatgtttgtcaacttaaccaatctccatgg |
11156956 |
T |
|
| Q |
120 |
gatgtgatcccctttgcctccaacaactcctcctcaatccaggttccaaacttcttcttctcttctcatatttattagggttttttcatatgctttatta |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11156957 |
gatgtgatcccctttgcctccaacaactcctcctcaatccaggttccaaacttcttcttctcttctcatatttattagggttttttcatatgctttatta |
11157056 |
T |
|
| Q |
220 |
gggttcttaatattcttcatctcact |
245 |
Q |
| |
|
|||||||||||| ||||||| ||||| |
|
|
| T |
11157057 |
gggttcttaatactcttcatgtcact |
11157082 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 20 - 236
Target Start/End: Original strand, 11163815 - 11164034
Alignment:
| Q |
20 |
ccctcttctattcacttgttccccttcacttctacaaaatggttcatttgcagttgaaatttttcaaacccatgtttgtcaacttaaccaatctccatgg |
119 |
Q |
| |
|
||||||||||||||||||||| ||||| | |||||||||||||||||| || | ||| | ||||||| || ||||||| |||||||||||||||||| |
|
|
| T |
11163815 |
ccctcttctattcacttgttcatcttcattgctacaaaatggttcattttcacctcaaaatcttcaaacacacatttgtcagcttaaccaatctccatgg |
11163914 |
T |
|
| Q |
120 |
gatgtgatcccctttgcctccaacaactcctcctcaat---ccaggttccaaacttcttcttctcttctcatatttattagggttttttcatatgcttta |
216 |
Q |
| |
|
|||||||||||||||| |||||||| ||||||||| || ||||||| |||||||||||||||||||| |||| ||||||||||||||||||||||||| |
|
|
| T |
11163915 |
gatgtgatcccctttgtctccaacagctcctcctcgattcaccaggttacaaacttcttcttctcttcttatatctattagggttttttcatatgcttta |
11164014 |
T |
|
| Q |
217 |
ttagggttcttaatattctt |
236 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
11164015 |
ttagggttcttaatattctt |
11164034 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 55 - 129
Target Start/End: Original strand, 11176672 - 11176746
Alignment:
| Q |
55 |
aaaatggttcatttgcagttgaaatttttcaaacccatgtttgtcaacttaaccaatctccatgggatgtgatcc |
129 |
Q |
| |
|
|||||||||||||| || |||||| ||||||| | || |||||||| ||||||||||||||||||||||| |||| |
|
|
| T |
11176672 |
aaaatggttcatttccaattgaaacttttcaagcgcacgtttgtcaccttaaccaatctccatgggatgttatcc |
11176746 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 171 - 245
Target Start/End: Original strand, 11176753 - 11176830
Alignment:
| Q |
171 |
ttcttcttctcttctcatatttattagggtttt---ttcatatgctttattagggttcttaatattcttcatctcact |
245 |
Q |
| |
|
||||| ||||||||||| || |||||||||||| ||||||| || |||||||||||| ||||||||||| ||||| |
|
|
| T |
11176753 |
ttcttattctcttctcagatctattagggtttttttttcatatcattcattagggttcttcatattcttcatatcact |
11176830 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 55; Significance: 1e-22; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 20 - 134
Target Start/End: Complemental strand, 4704002 - 4703888
Alignment:
| Q |
20 |
ccctcttctattcacttgttccccttcacttctacaaaatggttcatttgcagttgaaatttttcaaacccatgtttgtcaacttaaccaatctccatgg |
119 |
Q |
| |
|
||||||||||||||||||||| ||||||| |||||||||| |||||| | |||||| |||||||| || |||||||| |||||||||||||||||| |
|
|
| T |
4704002 |
ccctcttctattcacttgttcgtcttcactactacaaaatgattcattaccggttgaaccttttcaaatgcacgtttgtcagcttaaccaatctccatgg |
4703903 |
T |
|
| Q |
120 |
gatgtgatccccttt |
134 |
Q |
| |
|
|||| ||||||||| |
|
|
| T |
4703902 |
gatgccatccccttt |
4703888 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University