View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2932_low_60 (Length: 237)
Name: NF2932_low_60
Description: NF2932
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2932_low_60 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 73; Significance: 2e-33; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 20 - 96
Target Start/End: Original strand, 12445172 - 12445248
Alignment:
| Q |
20 |
agttttcatattagctattatagtatgtacaatttgtgattactctccctttttaacttacctttttaaattatatg |
96 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12445172 |
agttttcatattagctattataatatgtacaatttgtgattactctccctttttaacttacctttttaaattatatg |
12445248 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 161 - 221
Target Start/End: Original strand, 12445313 - 12445373
Alignment:
| Q |
161 |
ttcaggtattgaagtgatcattttctatttttactttaatccatgtgacacaacatatacc |
221 |
Q |
| |
|
||||||||| ||||||||||||||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
12445313 |
ttcaggtatcgaagtgatcattttctacttttactttagtccatgtgacacaacatatacc |
12445373 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 172 - 211
Target Start/End: Complemental strand, 17466257 - 17466218
Alignment:
| Q |
172 |
aagtgatcattttctatttttactttaatccatgtgacac |
211 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
17466257 |
aagtgatcattttctacttttactttaatccatgtgacac |
17466218 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University