View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2932_low_62 (Length: 235)
Name: NF2932_low_62
Description: NF2932
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2932_low_62 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 10 - 216
Target Start/End: Original strand, 3934654 - 3934858
Alignment:
| Q |
10 |
aggagcagagatggacttgtatcaccacggtggggatgggggatggagacgcacgccagcagggggcatgttgtaggagtagatgcaaatggtaaactaa |
109 |
Q |
| |
|
|||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3934654 |
aggatcagagatggacttgtatcaccaaggtggggatgggggatggagacgcacgccagcagggggcatgttgtaggagtagatgcaaatggtaaactaa |
3934753 |
T |
 |
| Q |
110 |
gaataagatttcgatggagggaagggaggagaccttggataggagaccctgctgatattgctcttgatgagaactga-ataaaactttataggaacatgg |
208 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||| |
|
|
| T |
3934754 |
gaataagatttcgatggagggaag---ggagaccttggataggagaccctgctgatattgctcttgatgagaactgatgtaaaactttttaggaacatgg |
3934850 |
T |
 |
| Q |
209 |
aagcttgt |
216 |
Q |
| |
|
|||||||| |
|
|
| T |
3934851 |
aagcttgt |
3934858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University