View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2933_low_10 (Length: 202)
Name: NF2933_low_10
Description: NF2933
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2933_low_10 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 154; Significance: 7e-82; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 154; E-Value: 7e-82
Query Start/End: Original strand, 20 - 185
Target Start/End: Complemental strand, 40297696 - 40297531
Alignment:
| Q |
20 |
acattcatgcctgtgagagccttctgttcttgatggctgataagaggcatcatcgggaaacagcaattctttcactgaagaaatcaggtccggagcttcc |
119 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40297696 |
acattcatgcatgtgagagccttctgttcttgatggctgataagaggcatcatcgggaaacagcaattctttcactgaagaaatcaggtccggagcttcc |
40297597 |
T |
|
| Q |
120 |
cgagctccttacacaattctctgctggcattgctggtactggccttgctgtcgtgttatctgtgat |
185 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||| |
|
|
| T |
40297596 |
cgagctccttacacaattctctgctggcattgctggtactggccttgctgttgtgctatctgtgat |
40297531 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 85 - 170
Target Start/End: Complemental strand, 37600815 - 37600730
Alignment:
| Q |
85 |
attctttcactgaagaaatcaggtccggagcttcccgagctccttacacaattctctgctggcattgctggtactggccttgctgt |
170 |
Q |
| |
|
|||| ||| ||||||||||| ||||| |||||| | ||| | ||||||||| | ||||| ||||||||||| || ||||||||||| |
|
|
| T |
37600815 |
attccttcgctgaagaaatccggtcctgagctttctgagtttcttacacaaatttctgcaggcattgctgggacaggccttgctgt |
37600730 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University