View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2934_low_6 (Length: 242)
Name: NF2934_low_6
Description: NF2934
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2934_low_6 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 242
Target Start/End: Original strand, 7419064 - 7419304
Alignment:
| Q |
1 |
gttatagcaataacatccatatcagtagataaagaagaagcttcgagaatcttaaattagttatggagagagagaagaaatagtttgttttgctttttga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7419064 |
gttatagcaataacatccatatcagtagataaagaagaagcttcgagaatcttaaattagttatggagagagagaagaaatagtttgttttgctttttga |
7419163 |
T |
|
| Q |
101 |
tcagaag--tataaccgtaattttctttgctttcaagtgcaaattaagtaagtggtttggtttaggttttcttattaattttaactcacgcattattttt |
198 |
Q |
| |
|
||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7419164 |
tcagaagactataa---taattttctttgctttcaagtgcaaattaagtaagtggtttggtttaggttttcttattaattttaactcacgcattattttt |
7419260 |
T |
|
| Q |
199 |
tgttgactctcactcacacttttatatgggttgggtttcatctc |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7419261 |
tgttgactctcactcacacttttatatgggttgggtttcatctc |
7419304 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University