View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2936_low_4 (Length: 319)
Name: NF2936_low_4
Description: NF2936
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2936_low_4 |
 |  |
|
| [»] chr8 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 182; Significance: 2e-98; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 46 - 319
Target Start/End: Original strand, 42455537 - 42455811
Alignment:
| Q |
46 |
atcactttgatgatgtttaaccaaaaaatttattttgannnnnnnnnnnnaaacttttgaatgtttgttagatattttgaatatttcaaaagtaaattaa |
145 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42455537 |
atcactttgatgatgtttaaccaaaaaaattattttgattttttttttttaaacttttgaatgtttgttagatattttgaatatttcaaaagtaaattaa |
42455636 |
T |
 |
| Q |
146 |
ttcacattttattttgatccaattgattaaactttgttttcataaattacctttgatgtcttggtaaaatcagttttttactcttacgtatgnnnnnnnt |
245 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
42455637 |
ttcacattttattttgatctaattgattaaactttgttttcataaattacctttgatgtcttggtaaaatcagttttttactcttacgtatgaaaaaaat |
42455736 |
T |
 |
| Q |
246 |
caatcggaatgggataatttaccttatacgccccgaaga-ttttttgatgcacattacttacttttgcagctttt |
319 |
Q |
| |
|
||||||||| |||||||||||||||| ||||||| ||| |||||||||| |||||||||||||||||||||||| |
|
|
| T |
42455737 |
caatcggaaggggataatttaccttaaacgccccatagatttttttgatgtacattacttacttttgcagctttt |
42455811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 42455451 - 42455497
Alignment:
| Q |
1 |
atacgtgtctttggttcatttaacttgctacactaatttcaatgtat |
47 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42455451 |
atacgtgtctttggttcatttaacttgctacactaatttcaatgtat |
42455497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University