View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2937_high_4 (Length: 249)
Name: NF2937_high_4
Description: NF2937
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2937_high_4 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 17 - 249
Target Start/End: Original strand, 39917142 - 39917374
Alignment:
| Q |
17 |
cagtactagcagcagcatgagccaccacaacaagattaagagtgagtttcagttattcagtaatttcagtggctctcggcttaaaaagtttgtcgcaact |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39917142 |
cagtactagcagcagcatgagccaccacaacaagattaagagtgagtttcagttattcagtaatttcagtggctctcggcttaaaaagtttgtcgcaact |
39917241 |
T |
|
| Q |
117 |
gattctggctatggtggtgttgaagaatcagtttcaaacagtagcagtggtgtaaccgttgaggatatagcttatcctcgtcaaatcaacttggaacttt |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39917242 |
gattctggctatggtggtgttgaagaatcagtttcaaacagtagcagtggtgtaaccgttgaggatatagcttatcctcgtcaaatcaacttggaacttt |
39917341 |
T |
|
| Q |
217 |
cattggctataccctctccctctcaacagcaac |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
39917342 |
cattggctataccctctccctctcaacagcaac |
39917374 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University