View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2938_low_7 (Length: 228)
Name: NF2938_low_7
Description: NF2938
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2938_low_7 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 2 - 226
Target Start/End: Original strand, 8896948 - 8897172
Alignment:
| Q |
2 |
tatagcgcctaccatcactagaagttcttgaattcttagtaaccgcatttgaaataacctctccaacatagccacaactattaatatgatttgaagcatg |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
8896948 |
tatagcgcctaccatcactagaagttcttgaattcttagtaaccgcatttgaaatagcctctccaacattgccacgactattaatatgatttgaagcatg |
8897047 |
T |
|
| Q |
102 |
acaaaagtcattgccaaaaccctgaccagcactaggagaatcatgcactgcatgatccaaatcagnnnnnnnagcaaggttttggttgtgaaaactgtag |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||| |
|
|
| T |
8897048 |
acaaaagtcattgccaaaaccctgaccagcactaggagaatcatgcactgcatgatccaaatcagttttttcagtaaggttttggttgtgaaaactgtag |
8897147 |
T |
|
| Q |
202 |
ttagcgtcataacagcaattatgat |
226 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
8897148 |
ttagcgtcataacagcaattatgat |
8897172 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University