View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2940_low_6 (Length: 259)
Name: NF2940_low_6
Description: NF2940
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2940_low_6 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 1 - 244
Target Start/End: Complemental strand, 3206362 - 3206118
Alignment:
| Q |
1 |
atttccaatactctgattagcgtttaatttctcaaagaatttcatgatgccttgaagaggaagagaacaatagaaatataacaaatacggcaaaaattta |
100 |
Q |
| |
|
||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3206362 |
atttctaatactctgattagcgtctaatttctcaaagaatttcatgatgccttgaagaggaagagaacaatagaaatataacaaatacggcaaaaattta |
3206263 |
T |
|
| Q |
101 |
caaattt-gcttcttacacatattaacaaaatattcaagatctatgtattctcaacaaaaattacgagatataaatcttgcatagtaattttcgtcttct |
199 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3206262 |
caaattttgcttcttacacatattaacaaaatattcaagatctatgtattctcaacaaaaattacgagatataaatcttgcatagtaattttcgtcttct |
3206163 |
T |
|
| Q |
200 |
ggtctactaaaaaagcacatatacttgttttaaaaaggttggttt |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3206162 |
tgtctactaaaaaagcacatatacttgttttaaaaaggttggttt |
3206118 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University