View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2941_high_4 (Length: 254)
Name: NF2941_high_4
Description: NF2941
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2941_high_4 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 15 - 238
Target Start/End: Complemental strand, 5009891 - 5009663
Alignment:
| Q |
15 |
aaagacaagaaatgagtattttatacctggggttcaaaagatgaatgttgctaatcctttcccatggaatatagtgcagaaaaatttactactttgcttg |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5009891 |
aaagacaagaaatgagtattttatacctggggttcaaaagatgaatgttgcttatcctttcccatggaatatagtgcagaaaaatttactactttgcttg |
5009792 |
T |
|
| Q |
115 |
aacaatattgatcacgttaggagaagaaagcgttgtcttgtctcttctcttttctgttcgtgtgc-----tgtgactactgactagtaaagggttgattt |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
5009791 |
aacaatattgatcacgttaggagaagaaagcgttgtcttgtctcttctcttttctgttcgtgtgctgtgctgtgactactgactagtaaagggttgattt |
5009692 |
T |
|
| Q |
210 |
ggactttgtgtgacaacggatgagattgt |
238 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
5009691 |
ggactttgtgtgacaacggatgagattgt |
5009663 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University